Clone Dmel\RE33869

General Information
Symbol	Dmel\RE33869	Species	D. melanogaster
Name	RE33869	FlyBase ID	FBcl0203990
Feature type	cDNA_clone	Created / Updated	2005-11-02/2006-08-19
Computed gene(s)	Dmel\lark

Collection Status	BDGP
Known Problems	none
Library	RE
Strain	y; cn bw sp
Tissue Source	embryonic stage whole organism
Vector	pFLC-I
Sequence Data of the Insert
5' Sequence
Total bases	515
GenBank	BI237618
5' sequence data	AGTCACACTCTTCCAGACGTCACACGGTCATATTGCGGACGAAGTGCGGA TCGATTTGGAAAAATCTGCTGCTCGGCCTGGAAAGTAGAAAGTATAAAGC TCTGCGTTTATAATTTAATTTGCAGCCAAAGCCCGCTGCCGATCAGGTAT CGCGTTTGTTCGTCGCCGTTGTCGTCCTCCAACCGCGCCGCCGCCGCCGC CGCCGCGTAGATATCCATTTTCCGGGATTACCCCACCCAGAGTGATATAA ACGATATAACCGTGGACGACCACGCAGCGGAACCCGCTGCCACCATGCCC GGAGCCGGCACGTTCAAGTTATTCATCGGGAATCTTGACGAGAAGACACA GGCCACCGAGCTGCGTGCACTGTTCGAGAAGTACGGTACCGTCGTCGAGT GCGACGTGGTGAAGAACTATGGCTTCGTTCACATGGAGACGGAGCAGCAG GGTCGCGATGCCATACAGAATCTGAACGGTTATACGCTGAACGAGTTCGC CATCAAGGTGGAGGC
Library Information
Comments	The RE (Riken embryo) library was made from RNA extracted from Drosophila 0-22hr mixed stage isogenic y; cn bw sp strain embryos, polyA+ selected twice, RNA made by Ling Hong. cDNA was synthesized by priming with the oligo(dT) primed adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et. al., PNAS 95: 520-524; Carninci, P. et al., Methods Enzymol. 303: 19-44). Subsequently, full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al., Genomics 37: 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al., Biotechniques, in press). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al., Genome Res. 10: 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, the cDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al., Genomics, 2001, 77:79-90). cDNAs were transformed into DH5-alpha TonA strain.
Library Synonyms
Reported As
Symbol Synonym	RE (Stapleton et al., 2002)
Library References
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 1 )
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]